prkC [2019-08-01 11:14:32]

protein kinase C, induces Germination of spores in response to DAP-type, and not to Lys-type cell wall muropeptides, stimulates WalR activity

Locus: BSU_15770

Isoelectric point: 4.83

Molecular weight: 71.69 kDa

Protein length: 648 aa

Gene length: 1947 bp

Function: germination in response to muropeptides

Product: protein kinase

Essential: no

E.C.: 2.7.11.1

Synonyms: yloP

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Protein synthesis, modification and degradation → Protein modification → Protein kinases
• Lifestyles → Sporulation → Germination → Additional germination proteins
• Groups of genes → Membrane proteins
• Groups of genes → Phosphoproteins → Phosphorylation on a Thr residue

Gene

Coordinates: 1,651,142 1,653,088

Phenotypes of a mutant

• unable to germinate in response to muropeptides PubMed
• reduced growth at high salt PubMed

The protein

Catalyzed reaction/ biological activity

• ATP a protein = ADP a phosphoprotein (according to Swiss-Prot)
• phosphorylation of WalR on Thr-101 to stimulate its activity PubMed

Protein family

• protein kinase superfamily (according to UniProt)
• Ser/Thr protein kinase family (according to UniProt)

Domains

• contains three C-terminal PASTA domains (aa 356-424, 425-492, 493-559) (binds muropeptides) PubMed

Modification

• phosphorylation on Thr-290 PubMed, autophosphorylation on multiple threonine residues PubMed

Effectors of protein activity

• activated by muropeptides PubMed
• GpsB, DivIVA, and EzrA are required for stimulation of PrkC activity PubMed

Structure

• 4EQM (intracellular domain of the Staphylococcus aureus enzyme, 51% identity) PubMed
• 3PY9 (entire extra-cellular region of PrkC from Staphylococcus aureus) PubMed
• 4X3F (intracellular domain of the Mycobacterium tuberculosis enzyme, 36% identity, 68% similarity) PubMed

Localization

• inner spore membrane PubMed
• membrane PubMed
• division septum PubMed

Expression and Regulation

Operons

• Genes: prpC-prkC-cpgA-rpe-yloS
  Description: PubMed

Biological materials

Mutant

• MGNA-B134 (yloP::erm), available at the NBRP B. subtilis, Japan
• GP576 (spc), OMG302 (aphA3), available in Jörg Stülke's lab
• 1A820 ( prkC::erm), PubMed, available at BGSC
• 1A963 (no resistance), PubMed, available at BGSC
• 1A964 (no resistance), PubMed, available at BGSC
• BKE15770 (prkC::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_GATTAGCACTGATCTTCACC, downstream forward: _UP4_GATGAATAACAAGGAGGGAA
• BKK15770 (prkC::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_GATTAGCACTGATCTTCACC, downstream forward: _UP4_GATGAATAACAAGGAGGGAA

Expression vectors

• for expression/ purification from B. subtilis with N-terminal Strep-tag, for SPINE, in pGP380: pGP832, available in Jörg Stülke's lab
• for expression/ purification of the kinase domain from B. subtilis with N-terminal Strep-tag, for SPINE, in pGP380: pGP849, available in Jörg Stülke's lab
• for expression, purification in E. coli with N-terminal His-tag, in pWH844: pGP1001, available in Jörg Stülke's lab
• for expression, purification in E. coli with N-terminal Strep-tag, in pGP172: pGP825, available in Jörg Stülke's lab, PubMed

LacZ fusion

• pGP829 (in pAC7), available in Jörg Stülke's lab

References

Reviews

Loading

Phosphorylation of PrkC

Loading

Targets of PrkC-dependent phosphorylation

Loading

Phsiological role of PrkC

Loading

Expression/ localization of PrkC

Loading

Structure/ biochemistry of PrkC

Loading